MORPHOLOGICAL AND MOLECULAR CONFIRMATION OF THE CHALKBROOD (Ascosphaera apis) INFECTION IN HONEY BEE COLONIES

Ghazala Muzafar, Muhammad Asif Aziz, Javaid Iqbal, Mazhar Qayyum, Shah Alam, Farva Siddique, Junaid Ali Siddiqui

G. Muzafar1, M. A. Aziz2*, J. Iqbal3, M. Qayyum1, S. Alam2, F. Siddique4, and  J. A. Siddiqui5

1Department of Zoology, PMAS-Arid Agriculture University, Rawalpindi, Punjab, Pakistan

2Department of Entomology, PMAS-Arid Agriculture University, Rawalpindi, Punjab, Pakistan

3Department of Plant Protection, College of Food and Agricultural Sciences, King Saud University, P.O. Box 2460, Riyadh 11451, Saudi Arabia

4Department of Animal and Range Sciences, College of Agricultural, Consumer and Environmental Sciences, New Mexico State University, Las Cruces, New Mexico 88003-8003, United States

5School of Biological Sciences, Faculty of Science, The University of Hongkong, SAR, China

Corresponding Author: asifaziz@uaar.edu.pk
Published Online First: August 11, 2026

ABSTRACT

Infection by the fungal pathogen Ascosphaera apis causes chalkbrood, a major larval disease that threatens colony health and productivity of honey bee (Apis mellifera L.) globally. This study aimed to determine the prevalence and molecular identity of the pathogen and to access its phylogenetic relationship with internationally reported isolates. In this study, A. apis was identified using morphological and molecular approaches, and the prevalence of chalkbrood infection was assessed in 140 bee colonies. Analyses of chalkbrood mummies revealed that 40 colonies (28.57%) were infected with Ascosphaera spores. Pure isolates cultured on Potato Dextrose Agar (PDA), and PCR-based amplification using ITS gene-specific primers produced a specific 485 bp band, confirming A. apis in the samples. Sequence analysis confirmed the pathogen’s identity, and the sequences of A. apis (PQ199405 and PQ282636) were deposited in GenBank. BLAST and phylogenetic analyses of the ITS region sequences showed close similarity (99.12%) with A. apis isolates reported worldwide. This study provides the first molecular confirmation of A. apis in Pakistan and establishes its phylogenetic relationship with global chalkbrood isolates. A baseline dataset generated in this study is essential for future epidemiological studies and supports the development of effective management strategies against chalkbrood disease in regional apiculture.

Keywords: Chalkbrood disease, disease prevalence, honey bee, microscopic analyses, phylogenetic analysis
Open Access: This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license ( https://creativecommons.org/licenses/by/4.0/).

INTRODUCTION

 Honey bee (Apis mellifera L.) is widely recognized for its intricate social structure and remarkable pollination abilities. It also produces valuable products such as honey, propolis, beeswax, bee pollen and royal jelly (Hung et al., 2018; Abuagla et al., 2025). These ecosystem services and economic contributions make honey bees essential to both agriculture and biodiversity conservation (Iqbal, 2009; Alam et al., 2025). Honey bees play a critical role in the pollination of numerous fruits, vegetables, nuts, oilseed crops and melons in Pakistan (Ahmad and Aziz, 2017). Over 10,000 beekeepers manage nearly 1.1 million bee colonies, producing about 15,750 metric tons of honey annually in Pakistan (Usman et al., 2022). The economic value of pollination-dependent crops has been estimated at approximately $ 1.59 billion. Furthermore, beekeeping in Pakistan contributes substantially to the national economy, with an annual honey production exceeding 15000 tons and export valued of worth $ 9.8 million to international markets (Irshad and Stephen, 2013; Irshad and Stephen, 2014). Despite their ecological and economic importance, honey bees are facing multiple threats, including diseases, parasites, pesticides and environmental stressors, all of which significantly contribute to population decline (Iqbal and Mueller, 2007; Parveen et al., 2022; Brunet and Fragoso Fabiana, 2024; Alam et al., 2025; Iqbal et al., 2025).

 Chalkbrood is a globally prevalent fungal disease affecting honey bee brood and is caused by Ascosphaera apis (Maassen ex Claussen) Olive & Spiltoir (Castagnino et al., 2020; Das et al., 2023; Mráz et al., 2023). This fungal pathogen poses a significant threat to colony health, particularly under intensive beekeeping systems. In addition to Apis species, chalkbrood-like diseases have also been reported in several non-Apis bees, including bumblebees, carpenter bee (Xylocopa spp.), leafcutter bees, mason bees, and sweat bees, often caused by A. apis or closely related Ascosphaera species bees (Gilliam et al., 1994; Maxfield-Taylor et al., 2015; Rutkowski et al., 2023). This indicates that Ascosphaera can infect a broader range of bee hosts beyond honey bees.

 Larval infection by A. apis weakens brood development, disrupts colony productivity and reduces honey production (Aronstein and Murray, 2010; Evison, 2015). Infected larvae become mummified, with color changing from healthy pearly white to a conspicuous white or grayish hues and eventually turning black (Castagnino et al., 2020). The presence of white or grayish masses within the infected larvae also serve as a diagnostic feature of the disease (Borum and Ulgen, 2008; Tejerina et al., 2019). A. apis is a spore-forming fungus with specialized structures called asci, which contain fruiting bodies known as ascomata. The spores are typically oval or elliptical in shape (Deneke et al., 2023). Spores enter the environment from mummified infected larvae, and can be spread during hive inspections, through beekeeping activities, or via contaminated equipment, honey and other bee products (Simone-Finstrom et al., 2018). Furthermore, adult bees act as vectors, transmitting spores within the colony through food-sharing behaviors known as trophallaxis (Aronstein and Murray, 2010). Foraging bees can inadvertently transport fungal spores back to the hive, where nurse bees subsequently transfer contaminated food to larvae during feeding (Dosselli et al., 2016).

 Chalkbrood has been identified as one the major threat to A. mellifera in surveys conducted in selected areas of the Punjab and Khyber Pakhtunkhwa provinces of Pakistan (Khan et al., 2024). Chalkbrood is more prevalent in spring when the weather is cold and humid (Flores et al., 1996), and rapid brood growth makes it difficult for worker bees to maintain a constant brood nest temperature (Borum and Ulgen, 2008). The younger larvae (1-2 days old) are highly vulnerable to infection by this pathogen, while adult bees often not (Jensen et al., 2009). The detection of chalkbrood disease in honey bees relies on various methods, including morphological, and molecular approaches. Morphological detection involves visually inspecting larvae and pupae for characteristic symptoms such as mummification, abnormal coloration, and distorted body shapes. Molecular methods that amplify targeted nucleotide sequences, allow precise identification of A. apis using the internal transcribed spacer (ITS) region (Nilsson et al., 2008; Jensen et al., 2013). Molecular detection has been crucial for identifying A. apis using specific primers such as 3-F1, and 3-R1 (James and Skinner, 2005), or AscosF3 and AapisR3 (Murray et al., 2005), providing high sensitivity and specificity even in asymptomatic individuals (Jensen et al., 2013; Aziz and Alam, 2024). These molecular tools enable early detection and can significantly aid in disease management strategies in apiaries.

 Although the occurrence of chalkbrood is increasing globally, dedicated investigations in Pakistan remain limited. Existing literature is sparse and mainly descriptive primarily reporting chalkbrood as a disease of honey bees (Munir et al., 2024) or identifying it as major threat in survey-based assessments (Khan et al., 2024). The available work has largely addressed its management (Sarwar, 2016) rather than diagnostic confirmation or pathogen characterization. Consequently, there is a clear need for systematic diagnosis to verify the causative agent, clarify its phylogenetic relationship with global isolates, and quantity its incidence in bee colonies in Pakistan. The present research was designed to address these gaps through a detailed investigation, including the detection of A. apis, its morphological and molecular identification, and the determination of infection prevalence in selected colonies. The findings provide baseline data to support further research on geographical occurrence, temporal trends, and seasonal patterns of chalkbrood in Pakistan.

MATERIALS AND METHODS

Sample Collection and Chalkbrood Identification: Samples collected from 140 A. mellifera colonies, maintained at different locations (Table 1) were examined to access the occurrence of chalkbrood disease. The study employed proportional sampling based on the available colony numbers at each location, while maintaining a uniform sampling protocol across all sites. Study locations were selected based on the availability of honey bee colonies at different apiaries during the study period, and sampling periods were adopted from previously reported seasonal patterns of chalkbrood occurrence. Although sampling schedules varied among locations across months due to operational constraints, the same standardized sampling procedures were consistently applied at all sites to ensure methodological comparability. Consequently, sample sizes varied due to natural differences in colony availability across locations. Disease incidence in bee colonies was recorded on a weekly basis, from first week of March to the second week of May 2022. Visible mummies (5-20), complete or partially cannibalized, were observed inside the frames, on the bottom boards, or in dead bee traps. Chalkbrood mummies (hard, white or gray masses found within brood cells) were collected and transferred to Bee Research Unit Laboratory, PMAS-Arid Agriculture University, Rawalpindi, Pakistan. The collected samples were then stored at -20oC for subsequent analysis and confirmation. During sample collection, frames and specimens were carefully examined, focusing on scattered lidless cells, small holes in sealed brood, presence of white mycelium in the combs, and larvae coated with mycelium. Chalkbrood infection was more prevalent in cool and humid conditions. These observations facilitated to identify the potential chalkbrood infections.

Fungal isolation and Purification

Hyphal-tip Isolation: Isolation and purification were carried out following the protocol of Jensen et al. (2013). Briefly, each mummy was surface-sterilized in 10% sodium hypochlorite (NaClO) for 10 min. Following sterilization, the mummy was washed twice with sterile distilled water for 2 min. The mummy was then cut into smaller pieces and placed on Potato Dextrose Agar (PDA) plates. The plates were kept in darkness at 30-34°C, and fungal growth generally appeared within 2–4 days after incubation.

Single-Spore Separation: The mummies were first surface-sterilized, chopped and placed into a tube filled with sterile water. The mixture was vortexed to obtain spore suspension. The suspension was diluted to concentrations from 10-2 to 10-4 and evenly spread onto PDA plates. The media plates were incubated in complete darkness at 30°C for 2-3 days. A fungal plug was then extracted and transferred to fresh growth agar (PDA), which were incubated at 30°C for 4-6 days to promote further growth (Cheng et al., 2022).

Morphological Examination: The morphological confirmation of A. apis was conducted in the Laboratory of Fungal Plant Pathology of the University. After success culturing of the fungus at 30oC for 2-3 days, a small piece of hyphae was taken from the culture medium and suspended in 5 ml of sterile double-distilled water (ddH2O) in a 5 ml sterile tube, followed by gentle mixing. Two drops of homogenized suspension were placed on a new sterile slide and directly observed under a light microscope (Olympus Nea, Japan) (Jensen et al., 2013; Cheng et al., 2022).

Pathogenicity Bioassay: Ascospore cysts, produced from the mating of two opposing A. apis types, were carefully removed from the colony's surface to prepare a spore suspension. For this purpose, the spore cysts were added into tubes having sterile water along with glass beads. The tubes were vortexed for 30 seconds, and centrifuged for 1 min at 14000 rpm. The supernatant was discarded, and the spore pellet was re-suspended. These steps were repeated three time. The spore suspension was adjusted at spore concentrations of 5 x 106 spores/ml after counting with a hemocytometer; the spore concentration was adopted from the protocol described by Cheng et al. (2022). Three days old honey bee larvae were randomly collected from three different colonies, housed in 96-well plates, and fed 10 μl of the spore suspension, while sterile water served as the control. Three replicates, each containing four larvae (total 12 larvae) were cultured at 30°C and 90% relative humidity (RH) for 7-14 days, and larval morphology was observed daily (Cheng et al., 2022).

Molecular Confirmation of A. apis

DNA Extraction: DNA of purified fungi was extracted following the protocol of Reynaldi et al. (2003). A 100 mg of mycelium was transferred in a 1.5 ml centrifuge tube, mixed with 400 μl of extraction buffer and 200 μl of 10% SDS, and incubated at 80°C for 5 min. The samples were allowed to cool at room temperature for 10 min, followed by the addition of 300 μl of protein neutralizing solution, and subsequently the sample were kept on ice for 5 min. The samples were gently vortexed and centrifuged at 12000 rpm for 30 min at 4oC. Approximately 500 μl of the supernatant was transferred to a new 1.5 ml centrifuge tube, mixed with equal volume of phenol-chloroform-isoamyl alcohol (25:24:1), and centrifuged at 14000 rpm for 15 min at 4oC. The supernatant was carefully transferred to a new tube, then 600 μl of cold ethanol was added and mixed using a vortex mixer. The DNA was then precipitated by centrifugation at 10000 rpm for 20 min at 4°C. After carefully removing the ethanol, the DNA pellet was allowed to air dry for 5 min at room temperature. Finally, the DNA was resuspended in 30 μl of TE buffer and stored at -20oC. DNA quality and integrity was verified on agarose gel (2%) with ethidium bromide (2 μl). The DNA samples were stored at -20ºC for subsequent PCR analysis.

PCR Amplification: PCR amplification was performed in the Center Laboratory, Faculty of Agriculture, PMAS-Arid Agriculture University Rawalpindi, following the described protocol of Cheng et al. (2022). The final 50 μl reaction mixture contained 2 μl genomic DNA, 25 μl 2x Green Master mix (Thermo Scientific), 1 μl of forward and reverse primers, and 21 μl PCR grade water. The species-specific forward (AscoF3) and reverse (AapisR3) primers were adopted from Murray et al. (2005), which amplify the target ITS region of rDNA of A. apis, and producing a PCR band of 485 bp (Table 2). PCR conditions were optimized based on established protocols for A. apis, with slight modifications to achieve optimal amplification. The amplification was carried out using a My-Gene-TM Series Peltier thermal cycler (Model MGG96G) with an initial denaturation at 94°C for 10 min, followed by 30 cycles of denaturation at 94°C for 45 s, annealing at 60°C for 45 s, extension at 72°C for 1 min, and final extension at 72°C for 5 min (James and Skinner, 2005; Murray et al., 2005). Amplified PCR products were separated on a 1% agarose gel stained with ethidium bromide and visualized under UV illumination (MS Major Science USA).

DNA Sequencing: Purified PCR products were submitted for sequencing through Sanger dideoxy sequencing performed by Microgen Pvt. (https://hardydiagnostics.com/microgen). The obtained sequences were cleaned, edited and submitted to BLAST analysis in the GenBank database for identification. The sequences of A. apis isolates were added in GenBank with accession codes PQ199405 and PQ282636. Phylogenetic analysis was conducted using MEGA 11 (Molecular Evolutionary Genetics Analysis) by the Neighbor-Joining method (NJM) with 1,000 bootstrap values. This analysis aimed to access the evolutionary relationships between the isolates from this study and previously reported global isolates (Das et al., 2023),

Statistical analysis: The prevalence of chalkbrood disease from different apiaries was calculated using descriptive statistics with a 95% Confidence interval (Statistix 8.1 Software).

RESULTS

Prevalence of chalkbrood: Chalkbrood disease was assessed in bee colonies across different locations through sampling conducted from March to May (Table 3). A total of 40 colonies (28.57%) were found to be infected with chalkbrood across the sampled apiaries. Chalkbrood prevalence varied across the sampling period and among the surveyed apiaries. The disease prevalence was higher during the month of March compared to April and May. Variation in the number of positive colonies across sampling months reflects temporal variation in infection frequency. Temporal interpretations are based on available field data and should therefore be considered with appropriate caution due to variability in sample availability. The bee colonies from Mandra showed highest infection (48.39%, 15/31 colonies) during March, followed by University Research Farm Koont (40.91%, 9/22 colonies) and Panjgran (40.54%, 15/37 colonies). The lowest prevalence was found in Rawat (8.33%, 2/24 colonies) during the month of May (Table 3).

Symptoms of chalkbrood: The characteristic symptoms of chalkbrood disease were observed in the sealed brood areas during colony inspection. A scattered brood pattern was evident with the presence of mummified bee larvae (chalk mummies) in the cells (Fig 1A). The white and black mummified bee larvae were also noted at the bottom boards of the hive (Fig 1B).

Morphological and pathogenic characteristics

Pure culture and microscopic examination: The hyphal-tip isolation method revealed that chalkbrood produced small, white to gray, spherical colonies on PDA medium seven days after inoculation (Fig. 2A). Black spores of A. apis were observed at the junction points of colonies in cultured medium after 30 days of incubation at 30oC (Fig 2B). Microscopic examination revealed septate and branched hyphae with distinct conidiophores under 100x magnification. The hyphae were septate, 2.5–8 µm in diameter, with distinct dichotomous branching (Fig 2C). Spherical conidia were visible, enclosed in nearly hyaline, spherical spore cysts at 400x magnification (Fig 2D). Mature ascomata were brick-shaped, containing spherical hyaline asci, with the release of spores from ruptured spore cysts (Fig 2E).

Pathogenic assay: The pathogenicity assay showed larval morphological changes and mortality following in vivo inoculation of three days old larvae with A. apis spores (Fig. 3). The inoculation revealed that all larvae (12 per replicate) died within 24 h post-inoculation. The dead infected larvae displayed white mycelia and ascospores on the surface of the dead bee larvae seven days post-inoculation (Fig. 3B). Fourteen days after inoculation, the larvae body shrank and transformed into black mummies (Fig. 3C). The control larvae (fed sterile water) showed no fungal growth and retained their normal white appearance throughout the observation period.

Molecular confirmation of A. apis in bee colonies: Molecular identification of A. apis was performed on bee samples collected from various locations. PCR-based analysis amplified specific bands of 485 bp in five positive samples, confirming the presence of A. apis (Fig. 4) using specific primers (AscoF3 and Aapis R3) (Table 2). The amplified PCR products were sequenced, and sequences of A. apis isolates were submitted to GenBank (PQ199405 and PQ282636).

Phylogenic Tree analysis: Ascosphaera apis sequences (PQ199405 and PQ282636) were identified using BLAST analysis in the GenBank nucleotide database. Phylogenetic analysis of the ITS region revealed 99.12% identity with A. apis isolates reported from different countries. These closely related isolates ITS region sequences included NR_178140, MH859367, and KJ158165 (USA); KT373974 (Argentina); (PV056025 and PV056026 (Italy); KM242591 (Russia); and (MK910077 (China) (Fig. 5).

 Table 1. Details of sampling locations of apiaries for Ascosphaera apis collection

Sampling location

City, Province

Latitude

Longitude

Altitude (meter)

S1

University Research Farm Koont

Rawalpindi, Punjab

33.114789

73.012807

513

S2

Mandra

Rawalpindi, Punjab

33.371635

73.234334

501

S3

PMAS- AAUR (Arid Agriculture University)

Rawalpindi, Punjab

33.650454

73.080688

515

S4

Rawat

Rawalpindi, Punjab

33.496426

73.194274

570

S5

Panjgran

Rawalpindi, Punjab

33.149551

73.02945

528

S6

Salgran

Rawalpindi, Punjab

33.822453

73.275163

821

Table 2. Sequence of primer used for the Ascosphaera apis identification

Name

Sequence

PCR Product

Reference

AscoF3

(Forward Primer)

GCACTCCCACCCTTGTCTA

485bp

(Murray et al., 2005)

AapisR3

(Reverse Primer)

CCCACTAGAAGTAAATGATGGTTA

Table 3. Prevalence and molecular detection of Ascosphaera apis in different Apis mellifera colonies

S. No

Sampling location

Months

Humidity %

Positive / Total colonies

% Infected apiaries

S1

University Research Farm Koont

March

43.66

9/22

40.91

S2

Mandra

March

44.02

15/31

48.39

S3

PMAS- AAUR

April

27.88

7/18

38.89

S4

Rawat

May

18.62

2/24

8.33

S5

Panjgran

March

42.52

15/37

40.54

S6

Salgran

March

29.8

2/8

25.00

Total

40/140

28.57

MORPHOLOGICAL AND MOLECULAR CONFIRMATION OF THE CHALKBROOD (Ascosphaera apis) INFECTION IN HONEY BEE COLONIES — Figure 1

Figure 1. A) Chalk-like material covering infected bee larvae; B). Dead, mummified bee larvae from infected colonies.

 

MORPHOLOGICAL AND MOLECULAR CONFIRMATION OF THE CHALKBROOD (Ascosphaera apis) INFECTION IN HONEY BEE COLONIES — Figure 2

Figure 2. (A) Morphology of Ascosphaera apis cultured on PDA; (B) Opposing mating types of A. apis producing spores at the junction point; (C). Septate mycelium and conidiophores of A. apis; (D) Spore balls enclosed in spherical, nearly hyaline spore cyst; (E). Release of spores from ruptured spore cyst.

MORPHOLOGICAL AND MOLECULAR CONFIRMATION OF THE CHALKBROOD (Ascosphaera apis) INFECTION IN HONEY BEE COLONIES — Figure 3

Figure 3. In vivo bioassay: morphological changes in 3 days old bee larvae inoculated with A. apis spores: A) bee larvae one day after inoculation; (B) White mycelia and ascospores on the surface of infected larvae after seven days; (C) Black mummies formed 14 days after inoculation.

MORPHOLOGICAL AND MOLECULAR CONFIRMATION OF THE CHALKBROOD (Ascosphaera apis) INFECTION IN HONEY BEE COLONIES — Figure 4

Figure 4. Image of agarose gel electrophoresis showing PCR-amplified products with specific 485 bp bands in positive samples of Ascosphaera apis. M = 100-bp DNA ladder; Lane 1 = Postive control; Lane 2, 4 = negative control & negative sample (no band indicating absence of A. apis); Lane 3, 5-7 = postive samples showing presence of A. apis.

MORPHOLOGICAL AND MOLECULAR CONFIRMATION OF THE CHALKBROOD (Ascosphaera apis) INFECTION IN HONEY BEE COLONIES — Figure 5

Figure 5. Phylogenetic analysis of Ascophaera apis isolates (PQ199405 and PQ282636) based on ITS region sequences using the Neighbor-Joining method.

DISCUSSION

 The fungus Ascosphaera apis infects honey bee larvae, causing chalkbrood disease and leading to substantial colony losses under favorable environmental conditions (Deneke et al., 2023; Aziz and Alam, 2024). The rapid spread of this disease has been reported across many countries. Its occurrence and severity are closely influenced by environmental factors such as humidity and geographical location (Castagnino et al., 2020). This study provides the first molecular confirmation of the pathogen causing chalkbrood disease in Pakistani honey bee colonies, using DNA sequencing of samples collected from multiple locations of Punjab, and validated through laboratory pathogenicity assays. The epidemiological information on chalkbrood based on diagnostic studies offers baseline data for surveillance in the province and for devising effective chalkbrood management strategies.

 The current study recorded that 28.57% of the apiaries were infected with chalkbrood during the sampling period from March to May, likely due to increased humidity and temperature fluctuations favoring fungus growth and disease development. This disease prevalence during spring is particularly concerning, as this period coincides when bee population need to increase for maximizing honey production in early summer flows. Likewise, chalkbrood infection has been reported from other countries, at infection rate of 17.4% in Ethiopia (Deneke et al., 2023), 24.1% in Japan (Yoshiyama and Kimura, 2011), 24.6% in France (Chauzat et al., 2010), 25% to 50% in Turkey (Aydin et al., 2006; Borum and Ulgen, 2008). The chalkbrood prevalence in Pakistan is comparable to that reported in many regions worldwide. However, the slightly higher prevalence compared to some countries may be attributed to local climatic conditions, genetic susceptibility of bee populations, or beekeeping management practices. It is important to note that temporal comparisons in the present study are based on field-collected data with variable sample sizes across months; therefore, observed differences in monthly prevalence should be interpreted with caution.

 In the current study, microscopic examination of larval mummies from honey bee colonies revealed characteristics consistent with morphology of A. apis (Jensen et al., 2013). The culture medium was densely covered with white septate hyphae exhibiting dichotomous branching. Fungal isolates from both A. mellifera and A. apis, maintained on a common medium, produced black, globose spore cysts seven days after inoculation, with clearly visible spherical fruiting bodies. A. apis produces spherical spore cysts containing multiple spore balls composed of hyaline spores, and these morphological features closely match previous descriptions (Chen et al., 2018; von Knoblauch et al., 2024).

 Pathogenicity bioassay showed that three days old larvae inoculated by feeding with spores in sugar syrup died, and the larvae transformed into black mummies 14 days after inoculation. These observations are consistent with previous reports, where larvae fed a spore-containing diet developed fungal mycelium beneath the cuticle within 72 hours, showed clinical signs of chalkbrood by 78 hours, and the larval corpses were eventually fully covered by fungal mycelium (Aronstein and Murray, 2010).

 In this study, ITS gene was targeted for the molecular identification and genetic sequencing of A. apis isolated from A. mellifera larval samples. ITS gene is widely authentic to identify fungal species within the genus Ascosphaera at molecular level (Anderson et al., 1998). PCR confirmed the identification by producing amplified bands of 485bp using specific primers. Similarly, Jensen et al. (2013) also utilized PCR for molecular identification of A. apis. The combination of ITS-based identification and morphological confirmation of chalkbrood in the current study strengthens the reliability of the findings and reduces the risk of misidentification with closely related species of honey bee pathogens.

 The DNA sequences of A. apis were deposited in NCBI GenBank (PQ199405 and (PQ282636). Phylogenetic analysis revealed 99.12% similarity of these isolates with sequences NR_178140, and MH859367 from USA (Vu et al., 2019), and (KJ158165) (Maxfield-Taylor et al., 2015), Argentina (KT373974), Italy (PV056025 and PV056026), Russia (KM242591) and China (MK910077) (Disayathanoowat et al., 2020). The high genetic similarity suggests a conserved genetic structure of A. apis, indicating its potential global dissemination through bee trade or colony migration. This highlights the importance of early detection and effective management, which are critical for preventing losses of both bees and honey production. However, as the present study was conducted in selected regions, it does not represent the nationwide disease prevalence; therefore, year-round investigations are required to better understand the epidemiology of chalkbrood in the country.

Conclusion: This study provides baseline data on the prevalence and molecular diversity of Ascosphaera apis in honey bee colonies in Pakistan. The study offers the first microscopic and molecular confirmation of the fungus in the region. Chalkbrood disease is characterized by dead, mummified bee larvae in comb cells and on the hive floor, covered with a chalky white or greyish-black coating resembling cotton. Microscopic examination revealed Ascosphaera spores in 28.57% of sampled apiaries, and molecular gene sequence analysis of the ITS region confirmed the isolates as A. apis. These findings highlight the need for effective management strategies to control the spread of fungal spores and minimize the risk of chalkbrood outbreaks in bee colonies. Moreover, continuous surveillance and preventive measures are also essential to protect honey bees’ health and maintain colony productivity.

Acknowledgements: The authors are thankful for the research support through Ongoing Research Funding Program (ORF-2026-1070), King Saud University, Riyadh, Saudi Arabia. We thank Dr. Gulshan Irshad for providing valuable information on A. apis, and the Fungal Plant Pathology Laboratory, Department of Plant Pathology, PMAS-Arid Agriculture University Rawalpindi, Punjab, Pakistan, for laboratory access. Special thanks to Dr. Aysha Riaz for support with the experiments.

Author’s Contribution: Conceptualization: [MQ, MAA and JI]; Methodology: [GM, MAA and JI]; Investigation: [GM, SA and MAA]; Formal analysis: [GM, MAA, FS and MQ]; Data Curation: [MQ, JI and MAA]; Software [FS, SA, JAS and MAA]; Project administration [MAA, MQ and JI]; Validation: [JI, JAS and MAA]; Visualization [MAA, MQ and SA]; Writing - original draft preparation: [GM, FS and MAA]; Writing - review and editing: [JI, JAS and MAA]; Funding acquisition: [JI]; Resources: [MAA and MQ]; Supervision: [MAA, MQ and JI].

Competing interests: The authors have declared no competing interests

Funding: Ongoing Research Funding program (ORF-2026-1070), King Saud University, Riyadh, Saudi Arabia.

REFERENCES

Abuagla, M.I.B., J. Iqbal, H.S.A. Raweh, A.S.A. Abdelaziz, A.S. Alqarni (2025). Binary mixture of neonicotinoid–pyrethroid insecticide: Impact on survival, cognitive learning, and memory in Apis mellifera jemenitica. Biology 14(2): 147. https://doi.org/10.3390/biology14020147

Ahmad, S., M.A. Aziz (2017). A review: risk assessment of pesticides on honey bee and pollination of agriculture crops in Pakistan. Asian J. Agri. & Biol. 5(3): 140-150.

Alam, S., M. Aziz, J. Iqbal, I. Bodlah, G. Irshad, A. Zeshan (2025). Microsporidian Nosema spp. in honey bee colonies: Assessment of incidence, molecular characterization, and environmental correlations. J. Anim. Plant Sci. 36(6): 1544-1558. https://doi.org/10.36899/JAPS.2025.6.0131

Anderson, D.L., A.J. Gibbs, N.L. Gibson (1998). Identification and phylogeny of spore-cyst fungi (Ascosphaera spp.) using ribosomal DNA sequences. Mycol. Res. 102(5): 541-547. https://doi.org/10.1017/S0953756297005261

Aronstein, K.A., K.D. Murray (2010). Chalkbrood disease in honey bees. J. Invertebr. Pathol. 103(Suppl 1): S20-29. https://doi.org/10.1016/j.jip.2009.06.018

Aydin, L., E. Gulegen, I. Cakmak, A. Girisgin, H. Wells (2006). Relation between Nosema and Chalkbrood diseases, and its implication for an apiary management model. Bull. Vet. Inst. Pulawy 50(4): 471.

Aziz, M.A., S. Alam (2024). Diseases of Honeybee Apis mellifera, in: Aziz, M.A. (Ed.), Melittology - New Advances. IntechOpen; London (UK). 150 p. https://doi.org/10.5772/intechopen.1003947

Borum, A., M. Ulgen (2008). Chalkbrood (Ascosphaera apis) infection and fungal agents of honey bees in North-West Turkey. J. Apic. Res. 47: 170-171. https://doi.org/10.3896/IBRA.1.47.2.16

Brunet, J., P. Fragoso Fabiana (2024). What are the main reasons for the worldwide decline in pollinator populations? CAB. Rev. 19(1): 1-11. https://doi.org/10.1079/cabireviews.2024.0016

Castagnino, G.L.B., A.M. Ramírez, A. Meana, L. Montejo, L.V.Z. ITurralde, M.T.C.D. Simón (2020). Etiology, symptoms and prevention of chalkbrood disease: A literature review. Rev. Bras. Saúde Prod. Anim. 21(01): e210332020. https://doi.org/10.1590/s1519-9940210332020

Chauzat, M.-P., P. Carpentier, F. Madec, S. Bougeard, N. Cougoule, P. Drajnudel, M.-C. Clément, M. Aubert, J.-P. Faucon (2010). The role of infectious agents and parasites in the health of honey bee colonies in France. J. Apic. Res. 49(1): 31-39. https://doi.org/10.3896/IBRA.1.49.1.05

Chen, D., R. Guo, C. Xiong, Y. Zheng, C. Hou, Z. Fu (2018). Morphological and molecular identification of chalkbrood disease pathogen Ascosphaera apis in Apis cerana cerana. J. Apic. Res. 57(4): 516-521. https://doi.org/10.1080/00218839.2018.1475943

Cheng, X., L. Zhang, J. Luo, S. Yang, Y. Deng, J. Li, C. Hou (2022). Two pathogenic fungi isolated from chalkbrood samples and honey bee viruses they carried. Front. Microbiol. 13: 843842. https://doi.org/10.3389/fmicb.2022.843842

Das, R., R. Kumar, G. Kunal, S. Goldar, S. Dutta, S. Jha (2023). Detection of Ascosphaera apis, causing chalkbrood disease in the colonies of European honey bee, Apis mellifera in West Bengal, India. Sociobiology 70(4): e9192. https://doi.org/10.13102/sociobiology.v70i4.9129

Deneke, Y.A., B.S. Dero, A.S. Mekonnen (2023). Review on chalkbrood disease of honey bee. Vet. Med. 8(2): 47-55. https://doi.org/10.17140/VMOJ-8-176

Disayathanoowat, T., H. Li, N. Supapimon, N. Suwannarach, S. Lumyong, P. Chantawannakul, J. Guo (2020). Different dynamics of bacterial and fungal communities in hive-stored bee bread and their possible roles: A case study from two commercial honey bees in China. Microorganisms 8(2): 264. https://doi.org/10.3390/microorganisms8020264

Dosselli, R., J. Grassl, A. Carson, L.W. Simmons, B. Baer (2016). Flight behaviour of honey bee (Apis mellifera) workers is altered by initial infections of the fungal parasite Nosema apis. Sci. Rep. 6(1): 36649. https://doi.org/10.1038/srep36649

Evison, S.E.F. (2015). Chalkbrood: epidemiological perspectives from the host–parasite relationship. Curr. Opin. Insect Sci. 10: 65-70. https://doi.org/10.1016/j.cois.2015.04.015

Flores, J., M., J. Ruiz, A., J. Ruz, M., F. Puerta, M. Bustos, F. Padilla, F. Campano (1996). Effect of temperature and humidity of sealed brood on chalkbrood development under controlled conditions. Apidologie 27(4): 185-192. https://doi.org/10.1051/apido:19960401

Gilliam, M., B.J. Lorenz, S.L. Buchmann (1994). Ascosphaera apis, the chalkbrood pathogen of the honey bee, Apis mellifera, from larvae of a carpenter bee, Xylocopa californica arizonensis. J. Invertebr. Pathol. 63(3): 307-309. https://doi.org/10.1006/jipa.1994.1057

Hung, K.-L.J., J.M. Kingston, M. Albrecht, D.A. Holway, J.R. Kohn (2018). The worldwide importance of honey bees as pollinators in natural habitats. Proceedings of the Royal Society B: Biological Sciences 285(1870): 20172140. https://doi.org/10.1098/rspb.2017.2140

Iqbal, J. (2009). Stress activated protein kinase: Central mediator of stress-and infection- induced changes in sensory processing, learning and memory in honeybee (Apis mellifera). PhD Thesis (Published). Universität des Saarlandes., Saarbrücken., Germany. https://doi.org/10.22028/D291-22586

Iqbal, J., S. Ali, A. Zahid, A. Fatima, A. Zahra, K. Siddiqi, M. Ahmad (2025). Agriculture, pesticide pollution, and climate change—Interconnected challenges, in: Behnassi, M., Barjees Baig, M., Gupta, H., Sabbahi, R., Nain Gill, G., El Haiba, M. (Eds.), Food systems and biodiversity in the context of environmental and climate risks: Dynamics and evolving solutions. Springer Nature; Cham (Switzerland). 491-517 p. https://doi.org/10.1007/978-3-031-89167-0_18

Iqbal, J., U. Mueller (2007). Virus infection causes specific learning deficits in honeybee foragers. P. R. Soc. B. 274(1617): 1517-1521. https://doi.org/10.1098/rspb.2007.0022

Irshad, M., E. Stephen (2013). Value of insect pollinators to agriculture of Pakistan. Int. J. Agron. & Agri. R. 3(5): 14-21. https://doi.org/10.6084/m9.figshare.1384947

Irshad, M., E. Stephen (2014). Review: Pollination, pollinated and pollinators interaction in Pakistan. J. Bioresour. Manag. 1(1): 19-25. https://doi.org/10.35691/JBM.4102.0003

James, R.R., J.S. Skinner (2005). PCR diagnostic methods for Ascosphaera infections in bees. J. Invertebr. Pathol. 90(2): 98-103. https://doi.org/10.1016/j.jip.2005.08.004

Jensen, A., Bruun, B. Pedersen, Vest, J. Eilenberg (2009). Differential susceptibility across honey bee colonies in larval chalkbrood resistance. Apidologie 40(5): 524-534. https://doi.org/10.1051/apido/2009029

Jensen, A.B., K. Aronstein, J.M. Flores, S. Vojvodic, M.A. Palacio, M. Spivak (2013). Standard methods for fungal brood disease research. J. Apic. Res. 52(1): 1-39. https://doi.org/10.3896/ibra.1.52.1.13

Khan, M., S. Rani, A. Bushra, R.N. Memon (2024). Constraints and prospects of apiculture at Malakand and selected areas of Punjab, Pakistan. Pak. J. Med. Cardiological Rev. 3(4): 23-37.

Maxfield-Taylor, S.A., A.B. Mujic, S. Rao (2015). First detection of the larval chalkbrood disease pathogen Ascosphaera apis (Ascomycota: Eurotiomycetes: Ascosphaerales) in adult bumble bees. PLoS One 10(4): e0124868. https://doi.org/10.1371/journal.pone.0124868

Mráz, P., M. Žabka, I. Hoštičková, M. Kopecký, A. Bohatá, A. Tomčala, M. Hýbl (2023). Effect of selected botanical compounds on Ascosphaera apis and Apis mellifera. Ind. Crops Prod. 197: 116649. https://doi.org/10.1016/j.indcrop.2023.116649

Munir, M., A.R. Munir, T. Khalid (2024). Biodiversity and challenges of honey bee population in Pakistan. Science Letters 12(1): 27-42. https://doi.org/10.47262/SL/12.1.132023950

Murray, K.D., K.A. Aronstein, W.A. Jones (2005). A molecular diagnostic method for selected Ascosphaera species using PCR amplification of internal transcribed spacer regions of rDNA. J. Apic. Res. 44(2): 61-64. https://doi.org/10.1080/00218839.2005.11101150

Nilsson, R.H., E. Kristiansson, M. Ryberg, N. Hallenberg, K.H. Larsson (2008). Intraspecific ITS variability in the kingdom fungi as expressed in the international sequence databases and its implications for molecular species identification. Evol. Bioinform. 4: 193-201. https://doi.org/10.4137/ebo.s653

Parveen, N., R. Miglani, A. Kumar, S. Dewali, K. Kumar, N. Sharma, S.S. Bisht (2022). Honey bee pathogenesis posing threat to its global population: A short review. Proc. Indian Natl. Sci. 88(1): 11-32. https://doi.org/10.1007/s43538-022-00062-9

Reynaldi, F.J., A.C. López, G.N. Albo, A.M. Alippi (2003). Differentiation of Ascosphaera apis isolates by rep-PCR fingerprinting and determination of chalkbrood incidence in Argentinean honey samples. J. Apic. Res. 42(4): 68-76. https://doi.org/10.1080/00218839.2003.11101096

Rutkowski, D., M. Weston, R.L. Vannette (2023). Bees just wanna have fungi: a review of bee associations with nonpathogenic fungi. FEMS Microbiol. Ecol. 99(8): 1-16. https://doi.org/10.1093/femsec/fiad077

Sarwar, M. (2016). Fungal diseases of honey bees (Hymenoptera: Apidae) that induce considerable losses to colonies and protocol for treatment. Int. J. Zool. Stud. 1(1): 8-13.

Simone-Finstrom, M., K. Aronstein, M. Goblirsch, F. Rinkevich, L. de Guzman (2018). Gamma irradiation inactivates honey bee fungal, microsporidian, and viral pathogens and parasites. J. Invertebr. Pathol. 153: 57-64. https://doi.org/10.1016/j.jip.2018.02.011

Tejerina, M.R., M.J. Cabana, J.M. Flores, M.R. Benítez Ahrendts (2019). Studies of Ascosphaera apis strains isolated from commercial poles of different Spanish provinces and their enzymatic production capacity. Arch. Zootec. 68(263): 324-330. https://doi.org/10.21071/az.v68i263.4189

Usman, M., M. Hasnain, S. Banaras, M. Akram, Q. Abbas, J.A. Shah, S. Tabasum, S.A. Shah, A. Raza, M.N. Khan, M. Jamil (2022). Potential emerging constraints and management strategies of different honeybee species in Pakistan. CAB. Rev. 17(58): 1-6. https://doi.org/10.1079/cabireviews202217058

von Knoblauch, T., A.B. Jensen, C.K.W. Mülling, H. Aupperle-Lellbach, E. Genersch (2024). Chalkbrood disease caused by Ascosphaera apis in honey bees (Apis mellifera)—Morphological and histological changes in infected larvae. Vet. Sci. 11(9): 415. https://doi.org/10.3390/vetsci11090415

Vu, D., M. Groenewald, M. de Vries, T. Gehrmann, B. Stielow, U. Eberhardt, A. Al-Hatmi, J.Z. Groenewald, G. Cardinali, J. Houbraken, T. Boekhout, P.W. Crous, V. Robert, G.J.M. Verkley (2019). Large-scale generation and analysis of filamentous fungal DNA barcodes boosts coverage for kingdom fungi and reveals thresholds for fungal species and higher taxon delimitation. Stud. Mycol. 92: 135-154. https://doi.org/10.1016/j.simyco.2018.05.001

Yoshiyama, M., K. Kimura (2011). Presence of Ascosphaera apis, the causative agent of chalkbrood disease, in honeybees Apis mellifera (Hymenoptera: Apidae) in Japan. Appl. Entomol. Zool. 46(1): 31-36. https://doi.org/10.1007/s13355-010-0008-8



Download Statistics
This Manuscript
Full Text
89
downloads
Indicators
Metrics

Impact Score: 0.65; h Index:51

SJR: 0.20

Indexing
Status

Web of Science (SCIE): Q3

SCOPUS (Q3)

Journal Metrics
Current

Journal Impact Factor (JIF): 0.6; JCR 2026 ; Five Year JIF: 0.7

HEC Category: W

ISSN Details
Verified

Print ISSN: 1018-7081

Electronic ISSN: 2309-8694

Search the Journal

Use the fields below to search for articles by Title, Author, or Keywords.

All Downloads
Full Text
359,431
downloads
Supplementary
1,299
downloads