EFFECTS OF MANNAN OLIGOSACCHARIDES ON RUMEN FUNGAL FLORA OF DAIRY COWS

C. Guo^†; Z. Fu^†; L. Zhang and X. Xu^*

^a College of Agriculture, Ningxia university, Yinchuan 750021, China

^†indicates the authors who contributed equally to this study

*Corresponding Author’s Email: xuxiaofengnd@126.com

ABSTRACT

To study the effects of mannan oligosaccharides (MOS) on rumen fungal flora of dairy cows, four lactating Chinese Holstein dairy cows were randomly divided into two groups in the two-stage 2 × 2 cross-over design. The experimental group (MT) was fed with a basal ration and MOS were perfused orally 60 g/(d head). The control group (CK) was fed with a basal ration. The rumen fluid was collected through the oral cavity of dairy cows using a negative pressure suction device. 50ml rumen fluid of every cow was collected each time respectively before feeding (0 h) and 2h, 4h and 6h after feeding in a day. The rumen fungi were tested by ITS sequencing technology. The results showed that four phyla were identified in CK group and five in MT group. The dominant phyla in both groups were Ascomycota, Basidiomycota, Neocallimastigomycota, whose abundances were more than 90% of the total rumen fungi. At the level of genus, 74 genera were identified in CK group, while 91 genera in MT group. Several cellulolytic fungi genera showed a decreasing trend or decreased significantly, such as Neocallimastigaceae-NA. The previous experiments that shows the addition of mannan oligosaccharides promoted the proliferation of rumen bacteria, while the growth of rumen fungi was inhibited in this result, which may be due to the antagonism between rumen bacteria and fungi. The growth of cellulose-degrading fungi was inhibited to some extend after the addition of MOS in the diet. Candida and Zopfiella, closely related to mycotic mastitis and immunosuppression respectively, had decreasing trends in rumen with supplemental MOS in the diets of the dairy cows, indicating that MOS might play a positive role in inhibiting harmful fungi. The experimental result shows that mannan oligosaccharides in the diet of dairy cows inhibited the growth of cellulolytic fungi and the proliferation of harmful fungi. In addition, the results showed that there might be the antagonistic effect between rumen fungi and bacteria potentially, which should be focused on for further study

Keywords: Sequencing technology, fungi diversity, fiber degradation, antagonism, gastrointestinal health.

https://doi.org/10.36899/JAPS.2021.5.0323
Published online January 21, 2021

INTRODUCTION

Mannan oligosaccharides (MOS) is an oligosaccharide composed of mannan or mannan with glucose through α-1,2, α-1,3, α-1,6 or β-1,3, β-1,4 glycosidic bonds, derived from outer layer of cell walls of S.cerevisiae. (Benites et al., 2008; Yan et al., 2008). MOS has been extensively researched in monogastric animals. According to the report of Chacher et al. (2017), MOS can improve cellular, humoral and skin immunity by activating macrophages in intestinal-related lymphoid tissue and also improve the growth speed and performance of broilers. From the slaughter experiments by Castillo et al. (2008), the MOS has beneficial effects on growth performance and nutrient digestibility of weaned piglets, and can also reduce diarrhea score of weaned piglets. MOS may protect intestine and improve immunity of animals. As a result, they have been widely used in research and production in numerous countries as a new feed additive. MOS also plays an active role in rumen fermentation, immunity and digestive function of ruminants. In recent years, researches on MOS in ruminants have been gradually carried out. Zheng et al. (2018) added 0%·kg^-1, 1.2%·kg^-1, 1.6%·kg^-1 and 2.0%·kg^-1 MOS in sheep diet respectively. It has been found that the addition of MOS can improve the antioxidant capacity of sheep, and also improve the fiber digestion of sheep. Franklin et al. (2005) supplied the MOS to the cows during the last 3 weeks of the dry period and then the cows were vaccinated against rotavirus at 4 weeks and 2 weeks before the expected parturition. The results have indicated that the addition of MOS to cows during the dry period can enhance their immune response to rotavirus.

The biggest difference between ruminants and monogastric animals is the rumen system, which contains ciliates, fungi and a large number of bacteria. Rumen fungi, which account for 5% to 20% of rumen microbial biomass, contain enzymes needed for digestion of plant feed, including cellulase, xylanase and other hydrolytic enzymes. Although rumen fungi do not account for much of the total rumen microorganisms, studies have showed their complexity and large amount of enzyme activities play a major role in digesting fiber (Akin and Borneman, 1990; Cammack et al., 2018; Rezaeian et al., 2004; Roger et al., 1992). As a result, it is of great significance to actual production to focus on the research on rumen fungus. Internal Transcribed Spacer (ITS) is a technique to obtain information on unknown fungi species by sequencing ITS DNA and then comparing the sequenced ITS sequences with known fungal ITS sequences. It is a method for analyzing the diversity of fungi (Vargas-Bello-Pérez et al., 2016). This study used ITS to investigate the effects of MOS on rumen microbial diversity in dairy cows focusing on the perspective of the diversity of rumen fungi.

MATERIALS AND METHODS

Experimental Animals and Feeding Management: Four lactating Chinese Holstein cows weighing about 550 kg in the similar parity were selected as experimental animals fed from August to October, 2018. The experimental animals were fed at a dairy farm in Yinchuan, Ningxia of China (106°27’E, 38°47’N). The daily milk production of the cows was about 30 kg. According to NRC (2001) dairy cattle feeding standard, the ratio of concentrate to roughage was 40:60 (DM basis, m:m). The composition and nutritional components of the diet were shown in Table 1. TMR feeding was used, and water was available ad libitum. 

Table1: Dietary composition and nutritional composition of dairy cow rations [%]

CP = crude protein; NDF= neutral detergent fiber; ADF= acid detergent fiber; NE_L = net energy for lactation;

Experimental Design

The cows were divided equally into control group (CK) and experimental group (MT). The cows in CK were fed with basal diet, while those in MT were fed with 60 g/head MOS in basal diet. MOS were perfused orally, twice in a day in the morning and evening before feeding. The experiment was designed as a 2 × 2 cross-over experiment. There were two stages in the whole experiment. Each stage lasted for 21d including 7 days of pre-feeding period and 14 days of the formal period. Finishing the first stage, the second stage of started after 14 days of recovery period. In the second stage, the treatments of previous control group and experimental group were exchanged to the other group.

Sample Collection and Processing: The rumen fluid was collected through the oral cavity of dairy cows using a negative pressure suction device. 50ml rumen fluid of every cow was collected each time respectively before feeding (0 h) and 2h, 4h and 6h after feeding in a day. In order to obtain representative samples, 5ml was taken out from every 4 samples of the same cows that were collected in one day and then mixed intensively. The samples were temporarily stored in freezing tube with liquid nitrogen and then transferred to the refrigerator at -80℃ in the laboratory for storage.

DNA Sample Extraction and Amplification

DNA Extraction: Rumen microbial DNA was extracted from 2 ml rumen fluid by kit method which were purchased from Nanjing Jiancheng Bioengineering Institute.

PCR Amplification: The purity and concentration of DNA samples were detected by agarose gel electrophoresis before amplification of PCR. After extracting genomic DNA from samples, ITS2 area of ITS rDNA was amplified with specific primers with barcode. The primer sequence was:

F：GCATCGATGAAGAACGCAGC;

R：ATATGTAGGATGAAGAACGYAGYRAA. (Ye et al., 2019）

Mixing and Purification of PCR Products: The PCR products were detected by electrophoresis with agarose gel with a gel concentration of 2%. The sample was mixed with equal concentration according to the concentration of PCR product. After mixing fully, the PCR product was detected by agarose gel electrophoresis with a gel concentration of 2%. Nanjing Jiancheng Bioengineering Institute provided the gel extraction kits to recover the products.

Hiseq Sequencing and Data: Samples were sent to Guangzhou GENE DENOVO Limited Company for Hiseq sequencing. Hiseq 2500 PE250 platform was used for the sequencing.

Statistical Software: The data were processed by Excel 2007, and the data were processed by ANOVA of two-stage cross design data in SAS 8.2. The data were showed by mean and standard error. P < 0.05 was regarded as the significant difference.

RESULTS AND ANALYSIS

Sample Sequencing Depth Analysis: The Shannon curve of the rumen fluid samples in this experiment was shown in Figure 1. As shown in the figure, when the depth of sequencing exceeded 5000 reads, the curve tended to be flat and the samples reached a saturation state, indicating that the depth of sequencing in this experiment was sufficient to cover most of the microorganisms in each sample.

OTUs Comparison: After Illumina Hiseq sequencing, the low-quality sequences were removed. The effective sequences were spliced and clustered into operational taxonomic units (OTUs) by Mothur according to 97% similarity. According to the results of OTU clustering analysis, the clustering information of different samples was analyzed, and then Venn graph was drawn based on the common and unique OTUs information. Figure 2 showed that the OTUs were 245 in MT group and 291 in CK group. There were 97 same OTUs shared in the both groups.

Analysis of Alpha Diversity of Rumen Fungi

Analysis of Alpha Diversity of Rumen Fungi

Table2: Indexes of Alpha diversity of rumen fungi of the dairy cows between CK and MT groups

CK=control group; MT=experimental group.

Alpha diversity is the analysis of species diversity in a single sample, including chao1, shannon and Simpson (Kemp et al., 2004). The chao1 predicts the species of microorganisms in the sample (the number of OTUs) based on the measured number of tags and OTUs and their relative proportions. It is relative values based on the known results. Shannon is a diversity index that reflects both OTU abundance and OTU uniformity. The larger the Shannon is and the closer the Simpson is to 0, the richer the species in the sample are.

Table 2 showed that, the Chao1 value and the Shannon value were both lower in MT group (321.64 and 2.51, respectively) than CK group (330.96 and 2.89, respectively), but there were no significant group differences (P = 0.26 and 0.61, respectively). The Simpson was higher in MT group (0.21) than CK group (0.09), but not significantly (P = 0.62).

Changes in the Structure of Rumen fungi

Analysis at the Level of Phylum

Table 3: The structure of ruminal fungi at phylum level of the dairy cows between CK and MT groups

CK=control group; MT=experimental group; NA = no annotation.

Using ITS rDNA sequencing technology, four phyla of fungi in the rumen fluid were identified in CK group and five phyla in MT group. According to Table 3, the preponderant phyla in both groups of rumen fungi were Ascomycota, Basidiomycota and Neocallimastigomycota . The abundance of these three phyla exceeded 90% of the total fungi in the rumen.The dominant rumen fungus Ascomycota showed an increasing trend in MT group (M = 83.24 ± 4.56%) than CK group (M = 72.34 ± 4.44%), but the difference was not significant (P = 0.091). The abundances of dominant fungi Basidiomycota and Neocallimastigomycota in MT group (M = 5.15 ± 1.52% and 5.72 ±3.70%, respectively) were 1.41 and 1.27 times lower respectively than those in CK group (M = 12.36 ± 5.11% and 15.18 ± 5.28%, respectively), but the differences were not significant (P = 0.247 and P = 0.211, respectively). The mean of Zygomycota abundance was 5.71% in MT group while there were little Zygomycota identified in CK group, but the group difference was not significant (P = 0.149).

Analysis at the Level of Genus: Table 4 showed the structure of rumen fungi at the level of genus. 74 genera of fungi in rumen fluid were identified in CK group, while 91 genera of fungi in MT group. Because there were plenty of genera of fungi identified, Table 4 only listed the dominant fungi (the abundance was more than 5%), the subdominant fungi (the abundance was 0.5% - 5%) and the fungi which had significant group differences. According to Table 4, five dominant genera of rumen fungi were identified in CK group, which were NA, Nectriaceae_NA, Piromyces, Saccharomyces and Aspergillus, and 9 subdominant genera, which were Candida, Pyronemataceae-NA, Neocallimastigaceae-NA, Mycosphaerella, Cladosporium, Zopfiella, Neocallimastix and Robillarda. Meanwhile, four dominant genera were identified in MT group, which were NA, Nectriaceae_NA, Aspergillus and Mortierella, and 10 subdominant genera, which were Piromyces, Saccharomyces, Neocallimastigaceae-NA, Mycosphaerella, Cladosporium, Neocallimastix, Sarocladium, Mortierella, Chaetomidium and Phaeosphaeriaceae-NA. In addition, Sarocladium increased in MT group (M = 1.01 ± 0.57%) compared to CK group (M = 0.02 ± 0.01%), a significant group difference (P < 0.05). The abundance of Mortierella was higher in MT group (M = 5.71 ± 3.40) than CK group (M = 0.00), but the group difference was not significant (P = 0.59). Neocallimastigaceae-NA (0.69 ± 0.31 vs 3.96 ± 1.33%), Phialosimplex (0.00 vs 0.02 ± 0.01%) and Chaetomiaceae-NA (0.00 vs 0.01 ± 0.00%) decreased in MT group compared to CK group, significant group differences (P < 0.05). The abundances of Candida (0.36 ± 0.33 vs 4.31 ± 2.41%), Zopfiella (0.06 ± 0.06 vs 3.27 ± 2.06), Neocallimastix (0.53 ± 0.47 vs 3.04 ± 1.05%) and Cryptococcus (0.00 vs 0.12 ± 0.08%) trended to be lower in MT group than CK group (P = 0.068, 0.086, 0.077 and 0.069, respectively). Besides, Pyronemataceae-NA, Robillarda and Geastrum appeared in CK group alone, while Mortierella, Chaetomidium and Phaeosphaeriaceae-NA appeared in MT group alone, but there were no significant group differences.

Table 4: The structure of rumen fungi at genus level of the dairy cows between CK and MT groups

CK = the control group; MT = the experimental group, NA = no annotation.

^a,b Values within a row with different superscripts differ significantly at P<0.05.

DISCUSSION

Effects of Mannan Oligosaccharides on Rumen Fiber Degrading Bacteria: Some rumen anaerobic fungi can secrete cellulase with high activity and degrade cellulose, hemicellulose and even lignin in many plant cells walls (Wei et al., 2016; Wood et al., 1986). Sarocladium can secrete cello-oligosaccharide oxidase (Lee et al., 2006). Neocallimastigaceae-NA and Neocallimastix belong to Neocallimastigaceae family, which plays a major role in the degradation of fibers in the rumen (Boots et al., 2013; Zhou et al., 2010). In this study, Neocallimastigaceae-NA (phylum Neocallimastigomycota), the dominant cellulolytic fungi in CK group, decreased significantly in MT group. In addition, Neocallimastix (phylum Neocallimastigomycota) showed a decreasing trend in MT group. Although Sarocladium (phylum Ascomycota) was higher significantly in MT group than CK group, its content was in a lower level than those decreasing in MT group. It was indicated that adding MOS to diets mostly inhibited the growth of cellulose-degrading fungi in general.

Researchers suggest that MOS significantly improve the DM, ADF and NDF degradation rates of corn silage, peanut vine, chinensis and alfalfa in rumen(Lin et al,2014). While the supplementation of MOS in the diet inhibited the growth of rumen fiber degrading fungi in this experiment. The results of our previous experiments show that adding mannan oligosaccharides to the diets of dairy cows obviously effects the amount of cellulose-degrading or hemicellulose-degrading bacterial flora. Among them, the relative abundance of hemicellulose-related species such as Anaerobiospirillum, Ruminococcus, Pseudobutyrivibrio and Lachnospira increase significantly or tend to increase with the same level supplementation of mannan oligosaccharides (Guo et al. 2018). The different results between rumen bacteria and fungi might be due to their antagonism. Bernalier et al. (1993) find that rumen coccus has antagonistic effect on cellulase activity of Neocallimastix. Dehority and Tirabasso (2000) have found that rumen bacteria can significantly inhibit the growth of rumen fungi by in vitro culture. The study of removing fungi from the goat rumen by Mao et al. (2002) has shown that the presence of anaerobic fungi in goat rumen can affect the protein concentration of rumen microbial, which suggests that there can be a strong antagonism between anaerobic fungi and other microorganisms in the rumen. In this experiment, the results of indexes of Chao1, Shannon and Simpson were consistent between the groups. Combined alpha diversity analysis and OTUs comparison, the results showed that adding MOS in diet trended to reduce the rumen fungi flora abundance of dairy cows to a certain extent, but there was no significant group difference. Further researches are needed.

Effects of Mannan Oligosaccharides on Gastrointestinal Health of Dairy Cows: MOS can promote the proliferation of beneficial bacteria, inhibit the reproduction of intestinal pathogens, reduce the incidence of gastrointestinal diseases, and enhance animal immunity (Bagheri et al., 2009; Uyeno et al., 2015; Westland et al., 2017). Studies have shown that the addition of MOS can improve the IgA of calves (Heinrichs et al., 2013). IgA, as the antibody secreted by the gut mucosa, plays an important role in gut barrier function (Planer et al., 2016). The results of this study showed that the abundance of Zopfiella had a decreasing trend with the addition of MOS in the diets. It has been found that Zopfiella has immunosuppressive characteristics (Fujimoto et al., 2004). In addition, Candida species are the most common microorganisms which can be isolated from infected mammary glands among the mycotic mastitis agents (Şeker and Özenç, 2011). In this experiment, Candida in rumen had a decreasing trend after the supplemental mannan oligosaccharides in the diets of the experimental cows. Furthermore, it has been reported that Mortierella can accumulate detectable amounts of arachidonic acid, one of the essential fatty acids, which is necessary nutrients for animals (Shinmen et al., 1989). It was shown in this study that he abundance of Mortierella in rumen had an increasing trend after the supplemental MOS in the diets of the experimental cows. This research indicated that MOS might play a positive role in inhibiting harmful fungi.

Conclusion: The study used ITS rDNA sequencing technology to analyze the changes of rumen fungal flora in dairy cows fed with or without mannan oligosaccharides. The results showed that mannan oligosaccharides in the diet of dairy cows inhibited the growth of cellulolytic fungi and the proliferation of harmful fungi. In addition, the results showed that there might be the antagonistic effect between rumen fungi and bacteria potentially, which should be focused on for further study.

Acknowledgements: The authors would like to thank the National Natural Science Foundation of China for financial support (31460619). Furthermore, thank colleagues and teachers in the Animal Nutrition Laboratory of Ningxia University for their assistance, as well as thank the sequencing results of samples from Guangzhou GENE DENOVO Limited Company.

REFERENCES

1. Akin, D.E., and Borneman, W.S. (1990). Role of rumen fungi in fiber degradation. Journal of Dairy Science, 73(10): 3023-3032.
2. Bagheri, M., Ghorbani, G.R., Rahmani, H., Khorvash, M., and Nili, N. (2009). Effect of live yeast and mannan-oligosaccharides on performance of early-lactation Holstein dairy cows. Asian-Australasian Journal of Animal Sciences, 22(6): 812-818.
3. Benites, V., Gilharry, R., Gernat, A., and Murillo, J.G. (2008). Effect of dietary mannan oligosaccharide from Bio-Mos or SAF-Mannan on live performance of broiler chickens. Journal of Applied Poultry Research, 17(4): 471-475.
4. Bernalier, A., Fonty, G., Bonnemoy, F., and Gouet, P. (1993). Inhibition of the cellulolytic activity of Neocallimastix frontalis by Ruminococcus flavefaciens. Microbiology, 139(4): 873-880.
5. Boots, B., Lillis, L., Clipson, N., Petrie, K., Kenny, D., Boland, T.M., and Doyle, E. (2013). Responses of anaerobic rumen fungal diversity (phylum Neocallimastigomycota) to changes in bovine diet. Journal of Applied Microbiology, 114(3): 626-635.
6. Cammack, K., Austin, K.J., Lamberson, W.R., Conant, G.C., and Cunningham, H.C. (2018) Tiny but mighty: The role of the rumen microbes in livestock production. Journal of Animal Science, 96(2): 752-769.
7. Castillo, M., Martin-Orue, S., Taylor-Pickard, J.A., Perez, J.F., and Gasa, J. (2008). Use of mannanoligosaccharides and zinc chelate as growth promoters and diarrhea preventative in weaning pigs: Effects on microbiota and gut function. Journal of Animal Science, 86(1): 94-101.
8. Chacher, M.F., Kamran, Z., Ahsan, U., Ahmad, S., Koutoulis, K.C., Din, H.Q.U., and Cengiz, Ö. (2017). Use of mannan oligosaccharide in broiler diets: An overview of underlying mechanisms. World's Poultry Science Journal, 73(4): 831-844.
9. Dehority, B., and Tirabasso, P.A. (2000). Antibiosis between ruminal bacteria and ruminal fungi. Appl. Environ. Microbiol., 66(7): 2921-2927.
10. Franklin, S., Newman, M.C., Newman, K.E., and Meek, K.I. (2005). Immune parameters of dry cows fed mannan oligosaccharide and subsequent transfer of immunity to calves. Journal of Dairy Science, 88(2): 766-775.
11. Fujimoto, H., Nakamura, E., Okuyama, E., and Ishibashi, M. (2004). Six immunosuppressive features from an ascomycete, Zopfiella longicaudata, found in a screening study monitored by immunomodulatory activity. Chemical and Pharmaceutical Bulletin, 52(8): 1005-1008.
12. Guo, T., Hu, D., Fu, Z., Li, N., and Xu, X. (2018). Effects of Mannan Oligosaccharides on rumen microflora structure of dairy cows based on 16S rDNA High-Throughput Sequencing Technology. Chinese Journal of Animal Nutrition, 30(10): 4048-4058.
13. Heinrichs, A., Heinrichs, B.S., and Jones, C.M. (2013). Fecal and saliva IgA secretion when feeding a concentrated mannan oligosaccharide to neonatal dairy calves. The Professional Animal Scientist, 29(5): 457-462.
14. Kemp, P., and Aller, J.Y. (2004). Bacterial diversity in aquatic and other environments: What 16S rDNA libraries can tell us. FEMS Microbiology Ecology, 47(2): 161-177.
15. Lee, M., Lai, W.L., Lin, S.F., Liu, Y., Hsu, Y.H., and Tsai, Y.C. (2006). Purification and characterization of a novel cellooligosaccharide oxidase from rice pathogen Sarocladium oryzae. Enzyme and Microbial Technology, 39(1): 85-91.
16. Lin, Y., Qi, R., Wang, L., Zhu, F., Zhao, F., and Hu, J. (2014). Effects of Exogenous Oligosaccharides on Enzymes Activities of Rumen Fluid and Degradation Rates of Roughages in Rumen of Laoshan Dairy Goats. Chinese Journal of Animal Nutrition,26(012):3616-3624.
17. Mao, S., Wang, Q., Yao, W., and Zhu, W. (2002). Effect of eliminating the anaerobic fungi on the metabolism and digestibility of rumen. Journal of Nanjing Agricultural University, 25(1): 61-64.
18. NRC [National Research Council] 2001 for dairy cattle: energy. Nuestra Cabaña, 2001.
19. Planer J.D., Peng Y., Kau A.L., Blanton L.V., Ndao I.M., Tarr P.I., Warner B.B., and Gordon J.I. (2016). Development of the gut microbiota and mucosal IgA responses in twins and gnotobiotic mice. Nature, 534(7606): 263-266.
20. Rezaeian, M., Beakes, G., and Parker, D.S. (2004). Distribution and estimation of anaerobic zoosporic fungi along the digestive tracts of sheep. Mycological Research, 108(10): 1227-1233.
21. Roger, V., Fonty, G., Andre, C., and Gouet, P. (1992). Effects of glycerol on the growth, adhesion, and cellulolytic activity of rumen cellulolytic bacteria and anaerobic fungi. Current Microbiology, 25(4): 197-201.
22. Şeker E., and Özenç E. (2011). In vitro biofilm activity of Candida species isolated from Anatolian buffaloes with mastitis in Western Turkey. Veterinarski Arhiv, 81(6): 723-730.
23. Shinmen Y., Shimizu S., Akimoto K., Kawashima H., and Yamada H. (1989). Production of arachidonic acid by Mortierella fungi. Appl. Microbiol. Biotechnol., 31(1): 11-16. 
24. Uyeno, Y., Shigemori, S., and Shimosato, T. (2015). Effect of probiotics/prebiotics on cattle health and productivity. Microbes and environments, ME14176.
25. Wei, Y., Yang, H.J., Luan, Y., Long, R.J., Wu, Y.J., and Wang, Z.Y. (2016). Isolation, identification and fibrolytic characteristics of rumen fungi grown with indigenous methanogen from yaks (Bos grunniens) grazing on the Qinghai‐Tibetan Plateau. Journal of applied microbiology, 120(3): 571-587.
26. Westland, A., Martin, R., White, R., and Martin, J. (2017). Mannan oligosaccharide prepartum supplementation: effects on dairy cow colostrum quality and quantity. Animal, 11(10): 1779-1782.
27. Wood, T., Wilson, C.A., McCrae, S.I., and Joblin, K.N. (1986). A highly active extracellular cellulase from the anaerobic rumen fungus Neocallimastix frontalis. FEMS Microbiology Letters, 34(1): 37-40.
28. Vargas-Bello-Pérez, E., Cancino-Padilla, N., and Romero, J. (2016). Technical note: use of internal transcribed spacer for ruminal yeast identification in dairy cows. Animal, 10(12): 1949-1954.
29. Yan, G., Yuan, J.M., Guo, Y.M., Wang, Z., and Liu, D. (2008). Effect of Saccharomyces cerevisiae mannan oligosaccharides on intestinal microflora and immunity in broilers. Journal of China Agricultural University, 13(6): 85-90.
30. Ye, W.X., Zhang, J., Li, N., Zhang, L.L., and Xu, X.F. (2019). Effect of Fructooligosaccharide on the Rumen Fungi Flora of Dairy Cows by ITS High-throughput Sequencing Technology[J]. Journal of Yunnan Agricultural University (Natural Science),34(6): 965-970.
31. Zheng, C., Li, F., Hao, Z., and Liu, T. (2018). Effects of adding mannan oligosaccharides on digestibility and metabolism of nutrients, ruminal fermentation parameters, immunity, and antioxidant capacity of sheep. Journal of Animal Science, 96(1): 284-292.
32. Zhou, L., Zhou, Y., An, P., and Liu, J. (2010). Advances in research and development of rumen anaerobic fungal cellulases. Chinese Journal of Animal Nutrition, 22(3): 536-543.

,