COMPARISON OF MOLECULAR AND SEROLOGICAL TESTS FOR DETECTION OF BRUCELLA ABORTUS IN ASYMPTOMATIC BOVINE BREEDING BULLS

S. Naz¹ , M. Azeem¹ , M. A. Hafeez² , K. Ashraf² , K. Asif¹ , A. Ali¹ , H. A. Ashfaq^1,3 , W. Shehzad⁴ , M. S. Imran², M. Tayyub² and Z. Fareed¹

¹Veterinary Research Institute, Lahore, Pakistan. ² Departmemts of Parasitology & Pathology, University of Veterinary and Animal Sciences, Lahore, Pakistan. ³Centre for Applied Molecular Biology, Lahore , Pakistan. ⁴Institute of Biochemistry and Biotechnology, University of Veterinary and Animal Sciences, Lahore, Pakistan.

Corresponding author’s e-mail: sarwat.naz141@gmail.com

ABSTRACT

Brucellosis is endemic in Pakistan and a serious threat to the healthy, profitable development of livestock in the country. Artificial insemination with semen collected from animals affected with Brucellosis is a potential source for the spread of the disease. Brucellosis is a bacterial zoonotic disease, which usually remains asymptomatic in male animals and can be easy to misdiagnose. Present study was designed to detect Brucella abortus (B. abortus) infection in asymptomatic bovine semen donor bulls. Efficiencies of IS711 conventional polymerase chain reaction (PCR),WboA/IS711J PCR which can differentiate wild/virulent strains from vaccine strain RB51, rose Bengal plate test (RBPT) and indirect enzyme linked immunosorbent assay (i-ELISA) were compared for detection of Brucellosis in breeding bulls. Blood samples were collected from 258 asymptomatic bovine breeding bulls (cattle bulls=118, buffalo bulls=140) maintained at well-organized semen production units in Punjab, Pakistan and five doses of semen of a pedigree buffalo bull (cryo-preserved in past on different dates).IS711PCR, RBPT, and i-ELISA were conducted for detection of B. abortus infection. Additionally, WboA PCR was conducted to substantiate that samples positive in IS711PCR contain DNA of B. abortus virulent strains but do not contain DNA of B. abortus vaccine strain. Out of 258 asymptomatic bulls, 26 were positive by IS711PCR, 5 by i-ELISA and RBPT declared all animals negative for B. abortus. All five doses of semen were found positive for B. abortus with PCR. A slight degree of agreement was observed between PCR and i-ELISA (κ=0. 17). PCR detected more samples positive for B. abortus infection among the three tests used in this study. In conclusion, IS711conventional PCR can be routinely used for an accurate and efficient diagnosis of Brucella infection in asymptomatic bulls, because the chances of non-detection of an infected animal in PCR are minimal. B. abortus positivity rate with IS711 conventional PCR was significantly higher in buffalo bulls (17. 86%) than cattle bulls (0. 88%) p-value < 0. 0001. WboA/IS711J PCR detected that all IS711PCR positive animals had DNA of B. abortus wild strains but not of B. abortus vaccine strain RB51. WboA/IS711J PCR detected 4 more animals positive for B. abortus than IS711PCR. Some amplicons of WboA/IS711J PCR were sequenced and BLAST analysis of these sequences revealed that they matched 100% with the DNA sequence of B. abortus wild strains registered in the GenBank database.

Keywords: Breeding bulls, Asymptomatic, Detection, Brucellosis.

https://doi.org/10.36899/JAPS.2020.4.0099
Published online April 25, 2020

INTRODUCTION

Brucellosis is a zoonotic disease of great economic significance caused by gram negative bacteria belongs to the genus Brucella (Atluri et al., 2011). Brucella genus is divided into ten different species based on their pathogenicity and host specificity. B. abortus (seven biovars), B. melitensis (three biovars), B. suis (five biovars) B. canis, B. ovis and B. neotomae are considered classical species (Galinska and Zagórski, 2013), and other four species have been recognized more recently (Atluri et al., 2011). Brucellosis is a serious problem because the organisms show limited response to a wide range of antibiotics. Once an animal is infected it will remain a carrier for the rest of life, posing a serious threat to other healthy animals in its surroundings and humans. Brucella species infect the reproductive organs of the male and female (Walunj et al., 2019). The colonization of Brucella organisms in these organs is associated with high levels of erythritol over there (Essenberg et al., 2002).

abortus infects equally to livestock, wildlife, and humans (Neha et al., 2014; Verma et al., 2014; Kumar et al., 2016). The disease is endemic in many developing countries and is associated with decrease in the production of milk, meat, and the sacrifice of positive animals (Seleem et al., 2010). B. abortus in bovine females causes frequent abortions in the last trimester of pregnancy, anoestrous, repeat breeding, pyometra, metritis, and retention of placenta. In male B. abortus causes orchitis, which may be allied to vesiculitis and epididymitis but the disease usually remains asymptomatic (Junqueira-Junior et al., 2013). The semen from Brucella infected bulls contain 100-50,000 organisms/ml (Morgan and Mac-Kinnon, 1979) and is a source of transmission of disease in the case of artificial insemination (Philpott, 1994). Rapid and precise diagnosis of B. abortus in bulls engage in semen production is of fundamental importance to control the transmission of Brucellosis nationally and internationally.

Bacterial isolation is a gold standard test for diagnosis and confirmation of Brucellosis. But it is expensive and time-consuming due to the fastidious nature of Brucella organisms. Bacterial isolation for diagnosis of Brucellosis needs a well-structured laboratory with bio-safety containment level 3 and highly skilled staff to handle it due to the zoonotic potential of Brucella spp. (Kaynak-Onurdag et al., 2016).

Polymerase chain reaction (PCR) is an emerging and alternate to isolation in diagnostic microbiology because a minute quantity of sample is used for direct detection of pathogen’s DNA/RNA in the shorter period time with less exposure of a worker to an infectious agent (Mitka et al., 2007). PCRs have been developed for the detection of Brucella DNA in body fluids having a low number of non-viable Brucella organisms (Çiftci et al., 2017). Different nuclear regions of Brucella spp., including the genes coding for 16S ribo­somal RNA, BCSP31 protein, 16S-23S rRNA intergenic spacer region, porins-omp2a & omp2b, and the gene encoding insertion sequence IS711 have been evaluated for the detection of these bacteria in different nature of samples (Gupta et al., 2014).

Serological tests are an indirect method for detection of Brucellosis (Aliskan, 2008; Rekha et al., 2013). Rose Bengal Plate Test (RBPT), Milk ring test (MRT), Complement fixation test (CFT), Serum agglutination test (SAT), and Enzyme linked immunosorbent assay (ELISA) are commonly used tests for surveillance of Brucellosis (Manat et al., 2016). However, serological tests have two main drawbacks; one is the cross-reactivity of bacterial antigens to non-specific antibodies and second they give false negative results when the titer of antigen or antibody is very low. To overcome these drawbacks the World Organization for Animal Health (OIE), recommends to associate two serological tests in parallel to enhance the sensitivity of diagnosis of Brucella infection (OIE, 2018).

Bovine brucellosis due to B. abortus is a common problem in Pakistan (Akhtar et al., 2017). In Pakistan data about the prevalence of Brucellosis in dairy cattle and buffalo in various parts of the country is available (Abubakar et al., 2011) but no data regarding detection of Brucellosis in asymptomatic bulls engage in semen production is available.

The goal of our present study was to detect B. abortus infection in asymptomatic bovine bulls maintained for semen collection purposes with 1S711, WobA PCRs, RBPT & i-ELISA and to compare the efficacy of these tests for detection of Brucellosis in breeding bulls.

MATERIALS AND METHODS

Sample Collection: Blood samples were collected from total of 258 bovine bulls (cattle bulls=118, buffalo bulls=140) maintained at well-organized semen production units in Punjab, Pakistan from August, 2017 to October, 2017 and five doses of semen of a pedigree buffalo bull (cryo-preserved in past on different dates) from stock of semen available at a livestock farm, were provided by the manager to include in this study. Apparently, all animals were in good health conditions. Animals undergo parasitic examinations, screening for Brucellosis using RBPT and tuberculosis quarterly to biannually according to the schedule prescribed at those semen production units and animals reactive to RBPT antigen or tuberculin are removed from the herd. 

Five ml blood sample was aseptically collected by qualified veterinary doctors from each, of the selected 258 animals by jugular vein-puncture. The one-half portion of each blood sample was transferred into EDTA coated vacutainers (BD, USA). The remaining half portion of each blood sample was processed for serum separation. Blood and serum samples were stored at -20°C till tested.

In this study IS711 PCR, WboA PCR, RBPT and i-ELISA were applied for the diagnosis of bovine brucellosis. RBPT, & i-ELISA were performed using serum samples and for PCRs, DNA was extracted from whole blood samples. However, semen samples were tested only with PCRs.

DNA Extraction: Pure culture of B. abortus (strain 99) was obtained from the seed collection of Veterinary Research Institute (VRI), Lahore, Pakistan and revived on potato infusion agar. A medium-sized bacterial colony from 72 hour culture of B. abortus (strain 99) was suspended in 200 μl blood of brucella free cattle.

Lyophilized B. abortus RB51 live vaccine was suspended in sterile water as per recommendations of the manufacturer, 200 ul suspension was added in 2ml blood of brucella free cattle.

DNA was extracted from blood samples of 258 test animals, blood samples artificially contaminated with B. abortus (strain 99) & B. abortus RB51vaccine (control samples) and semen samples with column-based DNA extraction kit (Blood sv mini, GeneAll) following the protocol proposed by the manufacturer with minor modification. Semen samples were reconstituted in nuclease-free water. DNA was extracted from 200 µl volume of blood and semen. Extracted DNA was eluted from the column membrane with 50 µl of nuclease-free water. The quality of extracted DNA was checked through 1% gel electrophoresis. DNA was stored at -70°C until use in PCR.

PCR Amplifications of Insertion Sequence IS711: Amplification of nuclear element IS711 of B. abortus  was carried out by using primers:

Bru-AMOS-Ab(F) GACGAACGGAATTTTTCCAATCCC,

Bru-AMOS-IS711(R) TGCCGATCACTTAAGGGCCTTCAT

(Bricker and Halling,1994). The primers were analyzed using the Basic Local Alignment Search Tool (BLASTn; http://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi) and were synthesized from Macrogen Inc. (Korea).

All PCR reactions were carried in 25μl volume using PCR premix 2X AmpMaster^TMTaq(GeneAll, Cat No. 541-050), 10 pM of each forward & reverse primers and 1-5μl of template DNA. PCR amplification reactions were conducted in thermal cycler (DNA Engine, Bio-Rad ) with cycling conditions as follows: initial denaturation of template DNA at 95°C for seven minutes then 35 cycles of 95°C for 45 seconds, 64°C for 60 seconds, and 72°C of extension for 45 seconds. The final extension was at 72°C for 7 minutes.

The amplicons were run on 1.2 % agarose gel along with 100 bp plus DNA marker (Thermo Scientific) in Tris-acetate EDTA (TAE) electrophoresis buffer for 40 minutes at 100 V, stained with ethidium bromide and visualized with gel documentation system.

PCR Amplifications of Nuclear Sequence WboA/IS711J: Amplification of WboA of B. abortus wild strain and nuclear sequence IS711J of B. abortus RB51 was carried out by using differential primers:

wbo1-TTAAGCGCTGATGCCATTTCCTTCAC,

wbo3-GCCAACCAACCCAAATGCTCACAA (Vemulapalli et al., 1999;Sharifi-Yazdi et al., 2008). The primers were analyzed using the Basic Local Alignment Search Tool (BLASTn; http://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi) and were synthesized from Macrogen Inc. (Korea).

All PCR reactions were carried in 25-μl volume using PCR premix 2X AmpMaster^TMTaq (GeneAll, Cat No. 541-050), 10 pM of each forward & reverse primers and 1-5μl of template DNA, following cycling conditions described in above PCR because primers used in both PCRs have a same melting temperature.

The amplicons were subjected to 1.2% agarose (Bioworld, Cat No. 40100164) gel electrophoresis along with 100 bp plus DNA marker (Thermo Scientific) in Tris-acetate EDTA (TAE) electrophoresis buffer for 40 minutes at 100 V, stained with ethidium bromide and visualized with gel documentation system.

DNA Sequencing: Amplicons of WboA/IS711J PCR were purified using the Gene Jet Gel Extraction Kit (Cat No. K0691) according to the manufacturer’s instructions (Thermo Scientific). The quality of purified PCR products was assured through 1.2% agarose gel electrophoresis. The purified PCR amplicons were sent to 1^st BASE Singapore for Sanger sequencing through a local vendor.

The sequences of this study were analyzed using the basic local alignment search tool (BLAST) in the National Centre for Biotechnology Information (NCBI) database (https://blast.ncbi.nlm.nih.gov/Blast.cgi) to observe their similarity with internationally reported sequences. The sequences of our samples were submitted to GenBank for accession numbers.

Rose Bengal Plate Test: Rose Bengal Plate Test was performed using the B.abortus RBPT antigen from Veterinary Research Institute (VRI), Lahore, Pakistan prepared by depositing the killed B. abortus strain 99 cells stained with Rose Bengal dye and suspended in acid buffer pH 3. 65. Before starting the test, antigen and serum samples were brought to room temperature and the test was performed according to the procedure described in OIE (2018). Results were interpreted according to the endpoint described by Morgan et al. (1978). Complete agglutination of RBPT antigen and tested serum within 1 minute was recorded as positive, partial agglutination was considered doubtful, and no agglutination up to 4 minutes was declared negative.

Indirect Enzyme Linked Immunosorbent Assay: Indirect enzyme linked immunosorbent assay (i-ELISA) was performed using the kit (ID Screen^(R)) from ID.Vet, France following the manufacturer’s instructions. For each sample optical density(OD) values were recorded at 450 nm, the S/P Percentage was calculated as follows using the sample and control values (Walanj et al., 2019):

S/P = O.D. of the sample – O.D. of NC^* /O.D. of PC^** – O.D. of NC

NC^* Negative control, PC^** Positive control

Results were interpreted according to endpoint fixed by the manufacturer.

Statistical Analysis: Considering PCR as a gold standard diagnostic test, relative sensitivity, specificity, positive and negative predictive values of RBPT & i-ELISA were calculated by using the MedCalc Software (Version 12.3.0). The degree of agreement between i-ELISA and PCR results was determined by calculating the Kappa (k) values with 95% confidence intervals using SPSS version 22. Kappa values of 0. 01 indicate no concordance, values between 0. 1 - 0. 4 indicate weak concordance, values between 0. 41- 0. 60 indicate clear concordance, values between 0.61 - 0.80 indicate strong concordance, and values between 0. 81 and 1. 00 indicate nearly complete concordance. The Chi-square test was used to compare the B. abortus positivity rate in buffalo and cattle bulls.

RESULTS

DNA was successfully extracted from blood samples artificially contaminated with B. abortus strains 99 & RB51, (control samples), blood samples of 258 bulls and 5 semen samples.

The first PCR for amplification of IS711 was optimized in our lab conditions using DNA templates from the blood samples artificially contaminated with B. abortus strain 99 and DNA from the blood of healthy, Brucella free cattle. The amplified fragment of 498 bp was observed in blood sample artificially contaminated with B. abortus strain 99. Whereas in the blood of healthy Brucella free cattle, no PCR amplification fragment was observed (Figure 1: PC and NC). PCR assay of blood samples of bulls and semen samples yielded the PCR products of the same size i.e.498 bp (Figure 1, From 1to 9).

Out of 258 blood samples and five semen samples tested, 498 bp amplified fragment was recorded in 26 (10. 08%), blood samples and in all semen samples. However, 232 (89. 9%) blood samples showed negative results upon PCR (Table. 1).

PCR amplification of nuclear sequence WboA/IS711J of B. abortus using differential primers was also successfully optimized in our lab. PCR product of 1300 bp was obtained for B. abortus strain RB-51 and B. abortus S99 produced the PCR product of 456 bp (Figure 2). Out of 258 blood samples and five semen samples tested with WboA/IS711J PCR, 456 bp amplified fragments were recorded in 30 (11. 63%) blood samples and in all five semen samples. In 228 (88. 37%) blood samples no PCR amplification was recorded. 26 blood samples positive in IS711 PCR were also positive in WboA/ IS711J PCR and 4 blood samples negative in IS711PCR also yielded 456 bp PCR products (Table 1). PCR product of 1300 bp specific for B. abortus strain RB-51 was not observed in any blood sample of bulls and semen samples.

Upon BLAST analysis with default search parameters sequences of this study accession numbers MK843794, MK843795, MK843796, MK843797, MK843798, MK843799, MK843800 and MK843801 shared 100% sequence identity with one another and 100 % similarity with sequences of B. abortus virulent strain variants from various countries reported over the time to GenBank.

All serum samples (258) showed negative results for RBPT (Table 2). Out of 258 serum samples, 5 (1. 94%) were positive by i-ELISA and 250 (96. 9%) were negative and 3 (1. 16%) gave equivocal results (Table 2).

Among buffalo bulls, 17.86% and 20.71 % were positive with IS711 PCR and WboA/IS711J PCR respectively. While in cattle bulls 0.85% were positive with both PCR tests (Table 1).When we compare the B. abortus positivity rate in both animal species. B. abortus positivity rate was significantly higher in buffalo bulls than in cattle bulls p < 0.0001(x² =440, df=1).

When the efficacy of RBPT and i-ELISA was compared with PCR considering it, a gold standard. There was a slight agreement between PCR and i-ELISA (κ=0.17) for the detection of B. abortus in the blood samples of asymptomatic cattle and buffalo bulls (Table 3).

Table 1.Out-come of molecular tests for percent (%) detection of B. abortus in blood samples of buff and cattle bulls.

Table 2.Out-come of serological tests for percent (%) detection of B. abortus in blood samples of buff and cattle bulls.

Table 3.Comparison of efficacy of serological tests (RBPT and i-ELISA) for diagnosis of Brucellosis in bovine bulls considering PCR, a gold standard.

^*All samples were negative

DISCUSSION

Artificial insemination is a well-defined route of transmission of Brucellosis in cattle and buffalo herds (Morgan and Mac-Kinnon,1979; Philpott, 1994; Vinodh et al., 2008). To prevent the dissemination of disease through artificial insemination, collection and preservation of semen should be from Brucella free animals (FAO,2005). Brucellosis usually runs asymptomatic in male animals and can be easy to misdiagnose. Early and precise diagnosis of Brucellosis in semen donor bulls with a more sensitive and specific test is important (Junqueira-Junior et al., 2013) to check the spread of disease. In this study direct detection of B. abortus in the blood of semen donor bulls was carried with conventional PCR. PCR is a rapid test for direct confirmation of B. abortus in culture and clinical samples with excellent sensitivity and specificity (Kaushik et al., 2006; Ghorbani et al., 2013; Karthik et al., 2014). However, the method of DNA extraction and region of amplification determines the sensitivity and specificity of the test. In this study DNA was extracted from whole blood with commercial DNA extraction columns which yield DNA of good quality in sufficient quantity and lessen the problem of inhibition of amplification reaction which is in line with the findings of Al-Garadia et al., (2011); Ghorbani et al., (2013); Boeri et al. (2018). In PCR genetic elements insertion sequence IS711, Wbo A gene of B. abortus wild strains and IS711J of B. abortus strain RB51 were evaluated. The rationale for insertion sequence IS711 has been previously described in detail (Hailing et al., 1993, Moreno et al.,2002). Briefly, insertion sequence IS711 is present in multiple copies in the Brucella genomes and is stable and unique for each species of Brucella. The primers used for amplification of IS711 were those initially introduced by Bricker and Halling, (1994) and subsequently, these primers have been studied by many authors for detection and confirmation of B. abortus in cultures, aborted foetus, blood, milk, semen and serum samples with excellent sensitivity and specificity(Çiftci et al., 2017). But the specificity of these primers in our lab was checked against known cultures of B. abortus S99, Rhizobium and other bacteria closely related to Brucella (data not shown here).

IS711PCR assay yielded same amplified fragments of 498 bp for artificially, naturally infected blood and semen samples which is in line with Bricker and Halling (1994); Karthik et al. ( 2014); Akhtar et al. ( 2017) who also observed PCR fragments of same size in morbid samples of B. abortus infected animals. 

But drawbacks associated with IS711 PCR are; it can not detect B. abortus biovar 3 which is prevalent in neighbouring countries of Pakistan (Sharifi-Yazdi et al., 2008) that had never been studied here and cannot differentiate vaccine strain RB51 from wild strains of B .abortus. Second PCR test capable to amplify Wbo A gene of B. abortus wild strains and insertion sequence IS711J flanking the Wbo A gene of B. abortus strain RB51 was carried to make clear that animals positive in IS711 PCR were infected with wild strains of B. abortus but not with B. abortus vaccine strain RB51. Because in Pakistan at established livestock farms, farmers vaccinate precious animals with live, attenuated B. abortus strains RB51 to protect them from brucellosis. B. abortus strains 19 vaccination is not popular in Pakistan because of its cross-reactivity in serodiagnostic tests and abortion in pregnant cattle. PCR amplification of wboA/IS711J region in blood samples artificially contaminated with vaccine strain RB51, blood and semen samples were carried using a pair of primers (1 & 3) initially reported by Vemulapalli et al. (1999). Resolution of WboA/IS711J PCR amplicons on agarose gel revealed fragments of 456 bp in 30 naturally infected blood samples, blood samples artificially contaminated with B. abortus strain 99 and in all five semen samples. Whereas amplification fragment of 1300 bp was noted in blood samples artificially contaminated with B. abortus vaccine strain RB51 but 1300 bp fragment was not detected in any field blood or semen samples. Our findings are in line with Vemulapalli et al. (1999); Sharifi-Yazdi et al. (2008) who also recorded PCR products of two different sizes: 456 bp fragments with amplification of Wbo A gene in DNA from wide range of B. abortus virulent strains samples and 1300 bp fragment in DNA from vaccine strain RB51. DNA from four tested blood samples which were negative while amplification of nuclear sequence IS711also revealed PCR fragment of 456 bp on amplification of WboA gene this could be attributed to the presence of B. abortus biovars other than 1, 2 & 4. Sharifi-Yazdi et al. (2008) preferred WboA PCR amplification over IS711 PCR amplification for detection of B. abortus in Iran due to prevalence of B. abortus biovar 3 in their country. BLAST analysis showed that the sequences of this study matched 100% with the nucleotide sequence of B. abortus wild/virulent strains registered in the NCBI database which corroborated the specificity of WboA/IS711J PCR for differentiation between B. abortus wild strains and vaccine strain RB51.

In Pakistan, a documented policy for the control of Brucellosis at federal or provincial level is not available. RBPT is widely used in Pakistan for screening of brucellosis in buffalo & cattle herds because of its cost-effectiveness, easy to perform and rapid result gain. Most of the published data available in Pakistan about the prevalence of Brucellosis is driven with RBPT and is mostly about dairy animals. In our study, the performance of RBPT remained very low when compared with IS711 and WboA/IS711J PCRs. Out 258 bulls, 257 were negative and one animal was doubtful with RBPT. Similarly, 100% Brucella seronegative results were reported by Junqueira-Junior et al. (2015) when they tested serum samples of 177 bull maintained for breeding and semen collection in Brazil for brucellosis using two serological tests viz RBPT and 2-Mercaptoethanol tests which have been officialised in the country for confirmation of brucellosis. Out of 177 bulls seronegative for Brucellosis, 5.06 % found positive for B. abortus when their seminal plasma were tested. Araj et al. (2005) also reported that RBPT missed a serious portion of positive cases, in complicated and chronic cases of human Brucellosis when compared to PanBio ELISA kit.

But in this study i-ELISA kit IDVet. detected anti-Brucella IgG antibodies in serum samples of 1.94% bulls out of 258 tested without differentiating among species viz B. abortus, B. melitensis, B. ovis and B. suis which is an intrinsic inability of the kit. 

World Organization for Animal Health (OIE), has recommended associating RBPT with CFT/ELISA to enhance the sensitivity of diagnosis of Brucellosis in bovine and the same regimen is adopted in many countries to boost the efficiency of eradication policy without any discrimination about its use in male and female bovids.

In our study if we combine the results of both serological tests RBPT & i-ELISA then the numbers of samples detected positive for Brucellosis also remained very low compared to PCRs detected positive. This triggered us to conclude that the association of two serological tests in parallel is not a satisfactory approach for diagnosis of Brucellosis in asymptomatic breeding bulls. Similar concern has been shown by Junqueira-Junior et al. (2013) who detected brucella species DNA in the semen of breeding bulls which were seronegative according to the prescribed regimen to use two serological tests for diagnosis of Brucellosis in Brazil.

Conclusions: The study indicated that an inaccurate diagnosis of Brucellosis in bovine bulls might arise when the diagnosis is based on serological tests alone. PCR is more efficient than serological tests, to detect Brucellosis in apparently healthy bulls. Our study first time reported the presence of B. abortus in semen producing asymptomatic bulls in Pakistan. Findings of this study show that there is a need for devising proper diagnostic strategies for detection of Brucellosis in semen donor bulls to reduce transmission of disease among cattle herd.

Acknowledgments: The authors are grateful to the Director Provincial Diagnostic Laboratory, Livestock and Dairy Development Department Government of Punjab, Pakistan for ELISA and Director Veterinary Research Institute, Lahore, Pakistan to provide financial support to this study.

REFERENCES

1. Abubakar, M.,M. Mansoor and M.J. Arshed (2011). Bovine Brucellosis. Old and new concepts with Pakistan perspective. PakistanVet. J. 32(2): 1–9.
2. Akhtar, R., M.N. Anwar, I. Khan, H. El-Adawy, A. Aslam, G. Mustafa, S.F. Rehmani, M.Z. Saleem and S. Naz (2017). Pathological investigations of organ affinity of Brucella species and their cross species transmission. Pakistan Vet. J. 37(3):372-374 .
3. Al-Garadia, M.A.,S. Khairani-Bejo, Z. Zunita and A.R. Omar (2011). Detection of Brucella melitensis in blood samples collected from goats. J. Anim. Vet. Adv.10(11): 1437-1444.
4. Aliskan, H. (2008). Diagnostic value of Culture and serological methods in human brucellosis. Bul. 42(1):185–195.
5. Araj, G.F., M.M. Kattar, L.G. Fattouh, O. Bajakian and S.A. Kobeissi (2005). Evaluation of the PANBIO Brusella immunoglobulin G and IgM enzyme-linked immunosorbent assays for diagnosis of human brucellosis. Clin.Diagn. Lab. Immunol. 12(11):1334–1335.
6. Atluri, V.L., M.N. Xavier, M.F. deJong, A.B. den Hartigh and R.M.Tsolis (2011). Interactions of the human pathogenic Brucella species with their hosts. Annu. Rev. Microbio. 65:523–41.
7. Boeri, E.J., M.M. Wanke, M.J. Madariaga, M.L. Teijeiro, S.A. Elena and M.D.Trangoni (2018) Comparison of four polymerase chain reaction assays for the detection of Brucella in clinical samples from dogs. Vet. World. 11(2): 201-208.
8. Bricker, B.J. and S.M. Halling (1994).Differentiation of Brucella abortus 1, 2, and 4, Brucella melitensis, Brucella ovis, and Brucella suis bv. 1 by PCR. J. Clin.Microbiol. 32(11): 2660-2666.
9. Ciftci, A., T. Ica, S. Savasan, B. Sareyyupoglu, M. Akan and K.S. Diker (2017). Evaluation of PCR methods for detection of Brucella strains from culture and tissues. Trop. Anim. Health Prod. 49(4): 755-763.
10. Essenberg, R.C., R. Seshadri, k. Nelson and I. Paulsen (2002). Sugar metabolism by Brucellae. Vet. Microbiol. 90(1-40:249-261.
11. FAO/IAEA, (2005). Improving artificial breeding of cattle and buffalo in Asia - guidelines and recommendations.IAEA-TECDOC-1480:72pp. http://www.iaea.org/programmes/nafa/d3/public/ras-ai-mar04.pdf
12. Galinska, E.M. and J . Zagórski (2013). Brucellosis in humans – etiology, diagnostics, clinical forms. Ann. & Environ. Med. 20 (2):233-238.
13. Ghorbani, A., M.R. Khorasgani, H. Zarkesh-Esfahani, H. Sharifi-Yazdi, A.D. Kashani and H. Emami (2013). Comparison of serology, culture, and PCR for detection of brucellosis in slaughtered camels in Iran. Comp. Clin.Pathol. 22(5): 913-917.
14. Gupta, V.K., S. Nayakwadi, A. Kumar, Gururaj, A. Kumar and R.S. Pawaiya (2014). 
15. Markers for the molecular diagnosis of brucellosis in animals. Anim. Vet. Sci.2(35):31 – 39.
16. Hailing, S. M., F.M. Tatum and B.J. Bricker (1993). Sequence and characterization of an insertion sequence, IS711, from Brucella ovis. Gene. 133(1):123-127.
17. Junqueira-Junior, D.G., G.M.S. Rosinha, C.E.G. Carvalho, C.E. Oliveira, C.C.Sanches and A.M.C. Lima-Ribeiro (2013). Detection of Brucella DNA in the semen of seronegative bulls by polymerase chain reaction. Transbound.Emerg. Dis. 60(40:376-377.
18. Junqueira-Junior D.G., A.M.C. Lima-Ribeiro, and G.P. Moraes (2015). Diagnosis of bovine brucellosis in bulls by seroagglutination and seminal plasma agglutination tests. Semina CiênciasAgrárias 36(5):3203-3210.
19. Karthik, k., R. Rathore, P. Thomas, A. Elamurugan, T. R. Arum and K. Dhama (2014). Serological and molecular detection of Brucella abortus from cattle by RBPT,STAT and PCR and sample suitibity of whole blood for PCR.Asian J.Anim.Vet.Advan.9(4):262-269.
20. Kaushik, , D.K. Singh, A.K. Tiwari and R.S. Kataria (2006). Rapid detection of Brucella species in cattle by PCR. J. Appl. Anim. Res. 30(1): 25-28.
21. Kaynak-Onurdag, F., S. Okten and B. Sen (2016). Screening Brucella in bovine raw milk by real-time quantitative PCR and conventional methods in a pilot region of vaccination, Edirne, Turkey. J. Dairy Sci. 99(5): 3351-3357.
22. Kumar, A., V.K. Gupta, A.K. Verma, Sahzad, V. Kumar, Singh and N.C.P. Reddy (2016). Seroprevalence and risk factors associated with bovine brucellosis in western Uttar Pradesh, India. Ind. J. Anim.Sci. 86(2):131-135.
23. Manat, Y., A.V. Shustov, E. Evtehova and S.Z. Askendirova (2016). Expression, purification and immunochemical characterization of recombinant OMP28 protein of Brucella species. J. 6(2):71-77.
24. Mitka, S., C. Anetakis, E.Souliou, E.Diza, A.Kansouzidou (2007). Evaluation of different PCR assays for early detection of acute and relapsing brucellosis in humans in comparison with conventional methods. J. Clin. Microbiol. 45(4):1211–1218.
25. Moreno, E.,A. Cloeckaert and Moriyón (2002). Brucella evolution and taxonomy. Vet. Microbiol. 90(1-4):209-227.
26. Morgan, Wj., D.J. Machinno, K.P.W. Gill, S.G.M. Gowert and P.I.W. Norris (1978). Brucellosis diagnosis standard techniques. Central Veterinary Laboratory, New Haw, Weybridge.
27. Morgan, W.J.B. and D.J. Mac-Kinnon (1979). Brucellosis. In: Fertility and Infertility in Domestic Animals (Laing JA ed.), 3rd Ed. ELBS, Bailliere Tindall, pp. 171–198.
28. Neha, W. A., A.K. Verma, U. Jain and B. Bist (2014). Brucellosis in organized dairy farm: an investigation. Asian J. Anim.Sci. 8:29-33.
29. Office International des Epizooties –OIE (2018).Manual of standards for diagnostics tests and vaccines for terrestrial animals.Brucellosis( abortus,B. melitensis and B. suis).3.1.4:355-398. http://www.oie.int/standard-setting/terrestrial-manual/access-online/
30. Philpott, M. (1994). The dangers of disease transmission by artificial insemination and embryo transfer. Br. Vet. J. 149(4):339–369.
31. Rekha, V. B. , L. Gunaseelan, A. Subramanian and Y. Gowry (2013). A study on bovine Brucellosis in an organized dairy farm. Vet. world 6(9): 681- 685.
32. Seleem, M.N., S.M. Boyle and N. Sriranganathan (2010). Brucellosis: a re-emerging zoonosis. Microbiol. 140(3-4):392-398.
33. Sharifi-Yazdi, H., P. Khazraiinia, T. Zahraei-Salehi and A. M. Behroozikhah (2008). Development of a multiplex polymerase chain reaction assay for differentiation of field strain isolates and vaccine strains S19 and RB51 of Brucella in Iran. Iranian J. Vet. Res. 9(1):19-24.
34. Vemulapalli, R., J.R. McQuiston, G.G. Schurig, Sriranganathan, S. M. Halling and S. M. Boyle (1999). Identification of an IS711element interrupting the wboA gene of Brucella abortus vaccine strain RB51 and a PCR assay to distinguish strain RB51 from other Brucella species and strains. Clin.Diagn. Lab. Immunol. 6(5): 760-64.
35. Verma, A.K., K. Dhama, S. Chakraborty, A. Kumar, R. Tiwari, A. Rahal, Mahima and S.V. Singh (2014). Strategies for combating and eradicating important infectious diseases of animals with particular reference to India: present and future perspectives. Asian J. Anim. Vet. Adv. 9:77-106.
36. Vinodh, , G.R. Dhinakar, R. Govindarajan and V. Thiagarajan (2008). Detection of Leptospira and Brucella genomes in bovine semen using polymerase chain reaction. Trop. Anim. Health Prod. 40(5): 323–329.
37. Walunj, T., P. Mhase, S. Bhave, D. Muglikar and M. Pawade (2019). Detection of Brucellosis by Serological Techniques in Bovines. J. Curr. Microbiol. App. Sci. 8(2):2124-2134.